Albumin-derived amino acid sequence, use thereof for increasing the half-life of therapeutic proteins and of other therapeutic compounds and entities, and constructs comprising the same.
The present invention relates to an albumin-derived amino acid sequence that can be used to increase the half- life of therapeutic proteins and of other therapeutic compounds and entities.
The invention also relates to fusion proteins and other polypeptide constructs comprising said amino acid sequence. The invention further relates to therapeutic uses of such fusion proteins and constructs and to pharmaceutical compositions comprising such fusion proteins and constructs.
Other aspects, embodiments, advantages and applications of the invention will become clear from the further description herein.
Amino acid sequences that can be linked to a therapeutic moiety in order to increase the half -life thereof are well known in the art.
For example, WO 91/01743, WO 01/45746 and WO 02/076489 describe peptide moieties binding to serum albumin that can be fused to therapeutic proteins and other therapeutic compounds and entities in order to increase the half-life thereof.
WO 04/041865 by applicant describes Nanobodies™ directed against serum albumin (and in particular against human serum albumin) that can be linked to other proteins (such as one or more other Nanobodies directed against a desired target) in order to increase the half- life of said protein.
WO 97/24445, WO 96/18412 WO 01/79258 and WO 03/60071 describe various fusion proteins of a therapeutic protein and albumin or a fragment thereof.
The amino acid sequences that are described in the above prior art for increasing the half-life of therapeutic moieties have several disadvantages. For example, the proteins mentioned in WO 91/01743, WO 01/45746 and WO 02/076489 are of bacterial or synthetic origin, which is less preferred for use in therapeutics. Other amino acid sequences may interfere with the binding of serum albumin to FcRn, and because of this may not provide an optimal extension of the half-life. Yet other amino acid sequences have been generated against serum albumin from a specific species (such as man) and may therefore not be (sufficiently) cross-reactive with serum albumin from other species (i.e. for use in animal models). Other amino acid sequences may be too big to be suitably and/or efficiently
expressed as a fusion protein and/or may, for example when expressed in a desired host cell, not fold properly as such or when fused to other proteins or polypeptides.
The present invention solves these problems by providing amino acid sequences that can be linked to a therapeutic moiety in order to increase the half-life thereof. The amino acid sequences used in the invention are small proteins or polypeptides derived from serum albumin and can advantageously be obtained from any desired species of mammal, including man. The amino acid sequences used in the invention are preferably also capable of folding to form a binding domain or a fragment thereof (i.e. upon expression in a suitable host or host cell). The invention is based on the finding that the so-called domain IE of serum albumin
(or analogs, mutants, variants, parts or fragments thereof) can be used with advantage as a fusion partner in order to increase the half-life of therapeutic moieties such as proteins, compounds or other therapeutic entities. Without being limited to a specific explanation or hypothesis, it is assumed that one of the reasons for this is that domain El contains the amino acid residues that are involved in the interaction between albumin and the FcRn receptor, which is involved in prolonging the life-span of albumin in circulation (see Chaudhury et al., The Journal of Experimental Medicine, vol. 3, no. 197, 315-322 (2003).
The neonatal Fc receptor (FcRn), also termed "Brambell receptor", is an integral membrane glycoprotein consisting of a soluble light chain consisting of β2-microglobulin, noncovalently bound to a 43 kD α chain with three extracellular domains, a transmembrane region and a cytoplasmic tail of about 50 amino acids. The cytoplasmic tail contains a dinucleotide motif-based endocytosis signal implicated in the internalization of the receptor. The α chain is a member of the nonclassical MHC I family of proteins. The β2m association with the α chain is critical for correct folding of FcRn and exiting the endoplasmic reticulum for routing to endosomes and the cell surface.
The overall structure of FcRn is similar to that of class I molecules. The α-1 and α-2 regions resemble a platform composed of eight antiparallel β strands forming a single β-sheet topped by two antiparallel α-helices very closely resembling the peptide cleft in MHC I molecules. Owing to an overall repositioning of the α-1 helix and bending of the C-terminal portion of the α-2 helix due to a break in the helix introduced by the presence of Pro 162, the FcRn helices are considerably closer together, occluding peptide binding. The side chain of Argl64 of FcRn also occludes the potential interaction of the peptide N-terminus with the
MHC pocket. Further, salt bridge and hydrophobic interaction between the a- 1 and oc-2 helices may also contribute to the groove closure.
FcRn therefore, does not participate in antigen presentation, and the peptide cleft is empty.
FcRn binds and transports IgG across the placental syncytiotrophoblast from maternal circulation to fetal circulation and protects IgG from degradation in adults. In addition to homeostasis, FcRn controls transcytosis of IgG in tissues. FcRn is localized in epithelial cells, endothelial cells and hepatocytes.
According to Chaudhury et al. (supra) albumin binds FcRn to form a tri-molecular complex with IgG. Both albumin and IgG bind noncooperatively to distinct sites on FcRn. Binding of human FcRn to Sepharose-HSA and Sepharose-hlgG was pH dependent, being maximal at pH 5.0 and nil at pH7.0 through pH 8. The observation that FcRn binds albumin in the same pH dependent fashion as it binds IgG suggests that the mechanism by which albumin interacts with FcRn and thus is protected from degradation is identical to that of IgG, and mediated via a similarly pH-sensitive interaction with FcRn. Using SPR to measure the capacity of individual HSA domains to bind immobilized soluble hFcRn, Chaudury showed that FcRn and albumin interact via the D-IQ domain of albumin in a pH-dependent manner, on a site distinct from the IgG binding site (Chaudury, PhD dissertation, see http://www.andersonlab.com/biosketchCC.htm; Chaudury et al. Biochemistry, ASAP Article 10.1021/bi052628y S0006-2960(05)02628-0 (Web release date: March 22, 2006))).
One of the advantages of using the domain in sequences of the present invention - compared to for example the use of full-sized albumin or of other albumin fragments (such as fragments containing domain I or II or parts thereof) - is that full-sized albumin or other albumin fragments may contain binding sites that can interact with other molecules, receptors, etc. in the circulation or on the surface of cells. By using a domain m sequence as described herein, rather than for example a polypeptide that comprises full-length albumin or a large portion of albumin, such interactions can be reduced or avoided. This can yield important advantages in that some of such interactions could negatively affect the potency or safety of molecules consisting of an antigen-binding moiety fused to albumin in order to extend its half-life, e.g. by cross-linking the albumin-fusion protein and bound target to other ligands or receptors or cells.
A second advantage of using the domain HI sequences of the present invention - compared to for example a polypeptide that comprises full-length albumin or a large portion
of albumin to extend half-life - is that a therapeutic moiety that is linked to the domain in sequence can further benefit from the FcRn-mediated transcytosis and transport, e.g. from transcytosis of protein through FcRn-bearing epithelial cells from the luminal to the apical site, or maternal -fetal transport. In such fusion proteins, the interaction with FcRn will be pH dependent in such way that there is a conditional binding at low pH, salvaging the fusion protein from lysosomal degradation in FcRn-positive cells, and recycling it back to the circulation. In contrast, when using an albumin-binding moiety fused to an antigen -binding moiety, the albumin-binding is typically not in such way pH-dependent that efficient binding occurs at low, intracellular pH and release at neutral pH (see also Hinton et al., J. Immunology 176:346 (2006)). Compared with the use of full-length albumin versus domain HI, the use of the latter will result in a protein with higher potency on a weight basis due to the use of a smaller protein (65 kD versus typically kD, respectively).
Figure 1 shows a sequence alignment of the amino acid sequences of domain III of rat serum albumin, mouse serum albumin, human serum albumin and bovine serum albumin. The amino acid sequence of domain El from human serum albumin is also given in SEQ ID NO.l. For a further description of domain IH of serum albumin, reference is for example made to Santra et al., Int. J. Biol. Macromol., Dec 2005., 37(4), 200-204; Ahmad et al., Biochim. Biophys. Acta. 1750 (1), 93-102 (2005); Matsush*ta et al., Pharm. Res. 21(1) 1924-34 (2004); and to the further references cited therein. Thus, in its broadest sense, the present invention relates to a construct comprising: a) at least one serum albumin domain III sequence; and b) at least one therapeutic moiety.
The term "construct" as used herein generally comprises any compound, molecule, (fusion) protein, conjugate, complex or other molecular entity in which the at least one serum albumin domain HI sequence is fused with, linked to (i.e. covalently or non-covalently) or otherwise bound to and/or associated with the at least one therapeutic moiety.
According to one preferred but non-limiting embodiment, the therapeutic moiety is covalently linked to the domain HI sequence. According to another preferred but non-limiting embodiment, the therapeutic moiety is a protein, polypeptide or other amino acid sequence that is fused to or otherwise covalently linked to the domain III sequence, so that the resulting construct is a (fusion) protein. Also, in the constructs of the present invention, the therapeutic moiety may be directly linked to or fused with the domain DI sequence or via a suitable linker or spacer, as will be clear to the skilled person.
As used herein, the term serum albumin domain HI sequence in its broadest sense refers to a polypeptide of 250 amino acids or less, preferably 200 amino acids or less, and more preferably 150 amino acids or less, that comprises or essentially consists of the amino acid sequence of domain III of a serum albumin or of an analog, mutant or variant thereof (as defined below).
The serum albumin, domain m sequence may be a derived from a naturally occurring serum albumin or may be of recombinant, synthetic or semi-synthetic origin. For example, instead of naturally occurring domain DI sequences, also analogs, mutants, variants, parts or fragments of a naturally occurring domain IH sequence may be used, in which such analogs, mutants, variants, parts or fragments again may be naturally occurring or of recombinant, synthetic or semi-synthetic origin (and in which analogs, mutants, variants, parts or fragments are preferably essentially as defined below for the analogs, mutants, variants, parts or fragments of the sequence of SEQ ID NO.l).
The serum albumin domain in sequence is preferably derived from or based on a serum albumin from a mammal, such as a rat, mouse, rabbit, dog, cow or monkey (for example a baboon or a cynomolgus or a rhesus or a chimpansee. As will be clear to the skilled person, when a construct comprising a serum albumin domain IH sequence is intended for use in an animal model (e.g. a disease model), preferably a serum albumin domain III sequence is used that is derived from the species of mammal in which said animal model is performed. The amino acid sequence used in the invention is preferably such that its binding to the FcRn receptor is dependent upon the pH, i.e. with an affinity at a pH of 7.0 or more which is less than 50%, such as less than 10%, in particular less than 5%, and may be less than 1% or even essentially zero (i.e. no binding affinity at pH 7.0 or more) than the maximum binding affinity in the range of 5,0 and 6,0. For reference purposes, the affinities of full-sized human serum albumin for FcRn at different pH values are as follows: pH 5.0: K D = 0.2-0.4 μM; pH 6.0: K 0 = 0.9-1.1 μM; pH 6.5 K D = 6.5-21 μM; pH 7.0 K D > 200-fold higher compared to K D at pH 5.0.
Thus, for example, the domain in sequence used in the present invention can be any fragment of albumin that can bind to or otherwise interact with the FcRn receptor at a pH in the range of 4.5 to 6.5, and in particular at a pH in the range of 5.0 to 6.0. For example, a domain IH sequence that has a higher affinity for interaction with the FcRn at pH 5-6 and that has reduced or essentially no binding at pH 7 may be selected in a similar way as has been
shown for IgG mutants (see Hinton et al, Journal of Biological Chemistry 279: 6213 (2004)) and then used in the present invention.
For therapeutic and diagnostic applications, preferably a serum albumin domain IE sequence of human origin is used.
More preferably, for therapeutic applications, the serum albumin domain in sequence used comprises or essentially consists of the amino acid sequence of SEQ ID NO: 1, or of an analog, mutant, variant, part or fragment thereof. Such analogs, mutants or variants may for example be naturally occurring analogs, mutants or variants or synthetic, semi-synthetic or recombinant analogs, mutants or variants. Such analogs, mutants or variants are preferably such that they have a degree of sequence identity with the amino acid sequence of SEQ ID NO: lof at least 70%, preferably at least 80%, more preferably at least 90%, such as at least 95%, in which, for the purposes of comparing two or more amino acid sequences, the percentage of "sequence identity" between a first amino acid sequence and a second amino acid sequence may be calculated by dividing [the number of amino acid residues in the first amino acid sequence that are identical to the amino acid residues at the corresponding positions in the second amino acid sequence] by [the total number of nucleotides in the first amino acid sequence] and multiplying by [100%], in which each deletion, insertion, substitution or addition of an amino acid residue in the second amino acid sequence - compared to the first amino acid sequence - is considered as a difference at a single amino acid residue (position).
Alternatively, the degree of sequence identity between two or more amino acid sequences may be calculated using a known computer algorithm for sequence alignment such as NCBI Blast v2.0, using standard settings. Some other techniques, computer algorithms and settings for determining the degree of sequence identity are for example described in WO 04/037999, EP 0 967 284, EP 1 085 089, WO 00/55318, WO 00/78972, WO 98/49185 and GB 2 357 768-A.
Usually, for the purpose of determining the percentage of "sequence identity" between two amino acid sequences in accordance with the calculation method outlined hereinabove, the amino acid sequence with the greatest number of amino acid residues will be taken as the "first" amino acid sequence, and the other amino acid sequence will be taken as the "second" amino acid sequence.
Also, in determining the degree of sequence identity between two amino acid sequences, the skilled person may take into account so-called "conservative" amino acid
substitutions, which can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure and which has little or essentially no influence on the function, activity or other biological properties of the polypeptide. Such conservative amino acid substitutions are well known in the art, for example from WO 04/037999, GB-A-2 357 768, WO 98/49185, WO 00/46383 and WO 01/09300; and (preferred) types and/or combinations of such substitutions may be selected on the basis of the pertinent teachings from WO 04/037999 as well as WO 98/49185 and from the further references cited therein.
Such conservative substitutions preferably are substitutions in which one amino acid within the following groups (a) - (e) is substituted by another amino acid residue within the same group: (a) small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro and GIy; (b) polar, negatively charged residues and their (uncharged) amides: Asp, Asn, GIu and GIn; (c) polar, positively charged residues: His, Arg and Lys; (d) large aliphatic, nonpolar residues: Met, Leu, He, VaI and Cys; and (e) aromatic residues: Phe, Tyr and Tip.
Particularly preferred conservative substitutions are as follows: Ala into GIy or into Ser; Arg into Lys; Asn into GIn or into His; Asp into GIu; Cys into Ser; GIn into Asn; GIu into Asp; GIy into Ala or into Pro; His into Asn or into GIn; He into Leu or into VaI; Leu into He or into VaI; Lys into Arg, into GIn or into GIu; Met into Leu, into Tyr or into De; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into VaI, into De or into Leu.
Any amino acid substitutions applied to the polypeptides described herein may also be based on the analysis of the frequencies of amino acid variations between hom*ologous proteins of different species developed by Schulz et al., Principles of Protein Structure, Springer- Verlag, 1978, on the analyses of structure forming potentials developed by Chou and Fasman, Biochemistry 13: 211, 1974 and Adv. Enzymol., 47: 45-149, 1978, and on the analysis of hydrophobicity patterns in proteins developed by Eisenberg et al., Proc. Nad. Acad Sci. USA 81: 140-144, 1984; Kyte & Doolittle; J Molec. Biol. 157: 105-132, 198 1, and Goldman et al., Ann. Rev. Biophys. Chem. 15: 321-353, 1986, all incorporated herein in their entirety by reference. Such analogs, mutants or variants are preferably such that they are capable of binding to the FcRn receptor with an affinity (i.e. a maximum affinity in the range of pH 5,0 to 6,0) that is no less than 0.1%, preferably no less than 1%, such as more than 10%, of the binding affinity of full-sized human serum albumin, as determined using a suitable assay (for
example an SPR assay or another suitable assay described in the art cited herein), and for which reference is made to the values mentioned herein
Such analogs, mutants or variants are again preferably such that their binding to the FcRn receptor is dependent upon the pH, i.e. with an affinity at a pH of 7.0 or more which is less than 50%, such as less than 10%, in particular less than 5%, and may be less than 1% or even essentially zero (i.e. no binding affinity at pH 7.0 or more) than the maximum binding affinity in the range of 5,0 and 6,0. For reference purposes, the affinities of full-sized human serum albumin for FcRn at different pH values are as follows: pH 5.0: K D = 0.2-0.4 μM; pH 6.0: K D = 0.9-1.1 μM; pH 6.5 K D = 6.5-21 μM; pH 7.0 K D > 200-fold higher compared to K D at pH 5.0.
Such an analog, mutant or variant may be selected in a similar way as has been shown for IgG mutants (see Hinton et al, Journal of Biological Chemistry 279: 6213 (2004)).
Such analogs, mutants or variants are preferably also such that they contain at least three histidine residues. More preferably, in such analogs, mutants or variants the three histidine residues at H464, H510 and H535 are essentially conserved.
Thus, preferably, analogs, mutants or variants comprise the amino acid sequence stretching from H464 to H535 (see Figure 1 and SEQ ID NO:2) or of an amino acid sequence that has a degree of sequence identity (as defined above) with the amino acid sequence of SEQ ID NO:2 of at least 70%, preferably at least 80, more preferably at least 90%, such as at least 95%.
Preferably, the analogs, mutants or variants contain at least 10 contiguous amino acid residues from the amino acid sequence of SEQ ID NO: 1 and in particular at least 10 contiguous amino acid residues from the amino acid sequence of SEQ ID NO:2, such as 20 contiguous amino acid residues from the amino acid sequence of SEQ ID NO:1 and in particular 20 contiguous amino acid residues from the amino acid sequence of SEQ ID NO:2.
When parts or fragments of a domain IH sequence are used in the invention, such parts or fragments may be parts or fragments of a naturally occurring domain IQ sequence or of an analog, variant or mutant thereof (as defined herein). The parts or fragments may for example be an N- and/or C- truncated amino acid sequence. Also, two or more parts or fragments as defined herein may be suitably combined to provide a (further) domain IE amino acid sequence.
Preferably, the parts or fragments contain at least 10 contiguous amino acid residues from the amino acid sequence of SEQ ID NO:1 and in particular at least 10 contiguous amino
acid residues from the amino acid sequence of SEQ ID NO:2, such as 20 contiguous amino acid residues from the amino acid sequence of SEQ ID NO: 1 and in at least 20 contiguous amino acid residues particular from the amino acid sequence of SEQ ID NO:2.
The parts or fragments used are preferably such that they at least comprise or span the amino acid residues that form the binding site of the domain DI and FcRn.
More preferably, such parts or fragments are such that they contain at least three histidine residues. More preferably, in such parts or fragments, the three histidine residues at H464, H510 and H535 are essentially conserved.
Thus, preferably, parts or fragments comprise or essentially consist of the amino acid sequence from H464 to H535 (see Figure 1 and SEQ ID NO:2) or of an amino acid sequence that has a degree of sequence identity (as defined above) with the amino acid sequence of SEQ ID NO:2 of at least 70%, preferably at least 80, more preferably at least 90%, such as at least 95%.
More preferably, such parts or fragments have a degree of sequence identity with the amino acid sequence of SEQ ID NO:1 of at least 40%, preferably at least 50%, more preferably at least 60%, such as at least 75, in which the degree of sequence identity is as defined above.
Such parts or fragments are preferably such that they are capable of binding to the FcRn receptor with an affinity that is no less than 0.1%, preferably no less than 1%, such as more than 10%, of the binding affinity of the corresponding naturally occurring domain ITI sequence, as determined using a suitable assay.
Such parts or fragments are preferably also such that their binding to the FcRn receptor dependent upon the pH, i.e. with an affinity at a pH of 7.0 or more which is less than 50%, such as less than 10%, in particular less than 5%, and may be less than 1% or even essentially zero (i.e. no binding affinity at pH 7.0 or more) than the maximum binding affinity in the range of 5,0 and 6,0. For reference purposes, the affinities of full-sized human serum albumin for FcRn at different pH values are as follows: pH 5.0: K D = 0.2-0.4 μM; pH 6.0: K D = 0.9- 1.1 μM; pH 6.5 K D = 6.5-21 μM; pH 7.0 K D > 200-fold higher compared to K D at pH 5.0.
The therapeutic moiety present in the constructs of the invention may be a protein, a compound, a small molecule or any other factor or entity. Generally, the therapeutic moiety may be any such moiety that can be fused with, linked (i.e. covalently or otherwise) or otherwise bound to or associated with the serum albumin domain HI sequence described
herein, and for which it is desired to increase the half-life. Examples of such therapeutic moieties will be clear to the skilled person, for example from the prior art referred to above.
More generally, it is envisaged that the serum albumin domain HI sequences described herein can be used analogously to the serum albumin fragments or serum albumin binding proteins or peptides that are described in the prior art above (i.e. to increase the half- life of the therapeutic moieties referred to in said prior art), simply by using a serum albumin domain m sequence as disclosed herein instead of the serum albumin fragments or serum albumin binding proteins or peptides described in said prior art.
Thus, for example, the therapeutic moiety may be a protein, a compound, a small molecule or any other factor or entity (such as a ligand) that is directed against a desired antigen or target, that is capable of binding to a desired antigen (and in particular capable of specifically binding to a desired antigen), and/or is that capable of interacting with a desired target, i.e. to provide a desired prophylactic or therapeutic effect.
In one non-limiting embodiment, the therapeutic moiety may be a protein, polypeptide or other molecule that is "directed against" an antigen, by which is meant that said protein or polypeptide can bind to, that has affinity for and/or that has specificity for a specific antigenic determinant, epitope, antigen or protein. Such a protein or polypeptide will also be referred to herein as an "antigen binding" protein or molecule.
The term "specificity" refers to the number of different types of antigens or antigenic determinants to which a particular antigen-binding molecule or antigen-binding protein can bind. The specificity of an antigen-binding protein can be determined based on affinity and/or avidity. The affinity, represented by the equilibrium constant for the dissociation of an antigen with an antigen-binding protein (K D ), is a measure for the binding strength between an antigenic determinant and an antigen-binding site on the antigen-binding protein: the lesser the value of the K D , the stronger the binding strength between an antigenic determinant and the antigen-binding molecule (alternatively, the affinity can also be expressed as the affinity constant (K A ), which is 1/KD). AS will be clear to the skilled person (for example on the basis of the further disclosure herein), affinity can be determined in a manner known per se, depending on the specific antigen of interest. Avidity is the measure of the strength of binding between an antigen-binding molecule and the pertinent antigen. Avidity is related to both the affinity between an antigenic determinant and its antigen binding site on the antigen-binding molecule and the number of pertinent binding sites present on the antigen-binding molecule. Typically, antigen-binding proteins will bind with a dissociation constant (K D ) of 10 "5 to 10 "12
moles/liter or less, and preferably 10 "7 to 10 "12 moles/liter or less and more preferably 10 '8 to 10 ~12 moles/liter, and/or with a binding affinity of at least 10 7 M "1 , preferably at least 10 8 M "1 , more preferably at least 10 9 M "1 , such as at least 10 12 M "1 . Any K D value greater than 10 "4 liters/mol is generally considered to indicate non-specific binding. Preferably, a Nanobody or polypeptide of the invention will bind to the desired antigen with an affinity less than 500 nM, preferably less than 200 nM, more preferably less than 10 nM, such as less than 500 pM. Specific binding of an antigen-binding protein to an antigen or antigenic determinant can be determined in any suitable manner known per se, including, for example, Scatchard analysis and/or competitive binding assays, such as radioimmunoassays (RIA), enzyme immunoassays (EIA) and sandwich competition assays, and the different variants thereof known per se in the art.
The antigen against which such an antigen-binding protein is directed may be any desired or suitable antigen, which may be hom*ologous or heterologous with respect to the host to which the construct of the invention is (to be) administered. For example, the antigen may be (present and/on or expressed by) a pathogen to the host (e.g. a bacterium, virus or parasite) or the antigen may be a protein, polypeptide or any other antigen or target (such as a receptor) that naturally occurs in said host (i.e. in the circulation of a host or in or on one or more cells or tissues of the host). For example, without being limited thereto, the antigen may be tumor necrosis factor alpha, interleukin-6 (IL-6), the IL-6 receptor or another protein or target involved in the EL-6 pathway (see for example the non-prepublished US provisional application US 60/873,012 by Ablynx N.V.), or amyloid-beta.
The therapeutic moiety may also be any other protein, polypeptide or other molecule or entity that is capable of effecting a desired prophylactic and/or therapeutic effect in a host to which the construct is administered. Thus, for example and without limitation, the therapeutic moiety may be a protein, polypeptide, small molecule or other ligand that is capable of interacting with a receptor on the surface of a cell in the host to which the construct of the invention is administered.
Suitable therapeutic moieties will be clear to the skilled person, for example from the prior art referred to herein. It is also within the scope of the invention that the therapeutic moiety used in the invention is only capable of providing the desired prophylactic or therapeutic effect (i.e. to a desired and/or therapeutically relevant degree) when it is administered as part of a construct as described herein. For example and without limitation, it may be that the therapeutic moiety,
when it is administered per se, has a half-life that is too short to provide the desired prophylactic or therapeutic effect (i.e. to therapeutically relevant degree), but may only do so when it is administered as part of a construct as described herein. It may also be that that the therapeutic moiety, when it is administered per se, has too may undesired side-effects to be used at therapeutically relevant doses, and that these side-effects are reduced when the therapeutic moiety is administered as part of a construct as described herein. For example, it may be that, when the therapeutic moiety is linked to a domain HI sequence as described herein, one or more sites for interaction with other proteins or targets (which may be responsible for the undesired side-effects) are "shielded" by the domain IE sequence, thus leading to a reduction of said interactions and thus of the undesired side effect. Similarly, the present of the domain III sequence may shield or mask one or more epitopes or antigenic determinants that may be present on the therapeutic moiety, thus leading to a reduction of the immunogenicity of the therapeutic moiety.
More preferably, the therapeutic moiety is, comprises or essentially consists of an immunoglobulin or immunoglobulin sequence (such as a fragment of an immunoglobulin). Generally, an "immunoglobulin" can be defined as a protein or polypeptide that has an immunoglobulin fold, as will be clear to the skilled person.
Even more preferably, the therapeutic moiety may be an antibody or antibody fragment (including but not limited to ScFv fragments) or comprise or essentially consist of an antibody or antibody fragment. For example, the therapeutic moiety may comprise or essentially consist of an antibody variable domain, such as a heavy chain variable domain or a light chain variable domain.
According to one preferred, but non-limiting embodiment of the invention, the therapeutic moiety comprises or essentially consist of at least one (single) domain antibody, at least one "dAb" (as described in for example EP 0 368 684 and by Ward et al., Nature, 341, 1989, p. 544).
Most preferably, the therapeutic moiety comprises or essentially consists of at least one Nanobody, and may for example comprises or essentially consist of a monovalent Nanobody or a multivalent (i.e. bivalent, trivalent, etc.) or multispecific (i.e. bispecific, trispecific, etc.) Nanobody construct. For such constructs, reference is for example made to Conrath et al., J. Biol. Chem., Vol. 276, 10. 7346-7350, 2001; Muyldermans, Reviews in Molecular Biotechnology 74 (2001), 277-302; as well as to for example WO 96/34103 and WO 99/23221. Some other examples of some specific multispecific and/or multivalent
polypeptides of the invention can be found in the published and non-prepublished patent applications by applicant; as well as in the further prior art mentioned therein. Reference is for example also made to WO 06/122786, WO 06/122825, WO 06/040153 and the non- prepublished US provisional application US 60/873,012 by Ablynx N. V., which describe Nanobodies against targets such as TNF, Von Willebrand factor, amyloid-beta, and the IL-6 receptor and other targets in the IL6 pathway.
Thus, for example, a construct of the invention can comprise at least one serum albumin domain EI sequence and at least one Nanobody, in which said at least one Nanobody is directed against a desired target. Other non-limiting examples of such constructs may for example comprise at least one serum albumin domain III sequence and two Nanobodies, in which said two Nanobodies are directed against the same target or epitope (i.e. to provide a bivalent monospecific Nanobody construct) or against two different targets or epitopes (i.e. to provide a bivalent bispecific Nanobody construct).
The at least one serum albumin domain DI sequence may be linked directly to the therapeutic moiety (i.e. as a direct polypeptide fusion or via a covalent linkage or bond), or via a suitable spacer or linker (such as a suitable amino acid sequence). Suitable examples of such spacers and linkers will be clear to the skilled person. For example, when the therapeutic moiety comprises or essentially consists of one (single) domain antibody, at least one "dAb", or a monovalent Nanobody or a multivalent (i.e. bivalent, trivalent, etc.) or multispecific (i.e. bispecific, trispecific, etc.) Nanobody construct, the linker may for example be a linker that is known in the art and/or can used to link such domains to each other in order to provide multivalent or multispecific constructs. Examples of such linkers will be clear to the skilled person, for example from the prior art mentioned above.
Unless indicated otherwise, all amino acid sequences, constructs, proteins, polypeptides and nucleic acid sequences described herein are preferably "(in) essentially isolated (form)", by which is meant that such amino acid sequences, constructs, proteins, polypeptides and nucleic acid sequences have been separated from at least one other component with which they are usually associated in (for example) their native biological source or the reaction medium or cultivation medium from which they have been obtained, such as another nucleic acid, another protein/polypeptide, another biological component or macromolecule or at least one contaminant, impurity or minor component. In particular, the amino acid sequences, constructs, proteins, polypeptides and nucleic acid sequences described herein are considered "essentially isolated'" when they been purified at least 2-fold, in
particular at least 10-fold, more in particular at least 100-fold, and up to 1000-fold or more from their native biological source or the reaction medium or cultivation medium from which they have been obtained. More preferably, the amino acid sequences, constructs, proteins, polypeptides and nucleic acid sequences described herein are preferably essentially hom*ogeneous, as determined using a suitable technique, such as a suitable chromatographical technique, such as polyacrylamide-gel electrophoresis.
When the therapeutic moiety or moieties are proteins or polypeptides, so that the construct of the invention is a fusion protein or polypeptide, the present invention also relates to a nucleotide sequence or nucleic acid that encodes a construct of the invention. Said nucleotide sequence can be DNA or RNA, and is preferably double stranded DNA.
Such a nucleic acid may also be in the form of, be present in and/or be part of a genetic construct, as will be clear to the person skilled in the art. Such genetic constructs generally comprise at least one nucleic acid of the invention that is optionally linked to one or more elements of genetic constructs known per se, such as for example one or more suitable regulatory elements (such as a suitable promoter(s), enhancer(s), terminator(s), etc.) and the further elements of genetic constructs referred to herein. Such genetic constructs comprising at least one nucleic acid of the invention will also be referred to herein as "genetic constructs of the invention".
The genetic constructs of the invention may be DNA or RNA, and are preferably double-stranded DNA. The genetic constructs of the invention may also be in a form suitable for transformation of the intended host cell or host organism, in a form suitable for integration into the genomic DNA of the intended host cell or in a form suitable independent replication, maintenance and/or inheritance in the intended host organism. For instance, the genetic constructs of the invention may be in the form of a vector, such as for example a plasmid, cosmid, YAC, a viral vector or transposon. In particular, the vector may be an expression vector, i.e. a vector that can provide for expression in vitro and/or in vivo (e.g. in a suitable host cell, host organism and/or expression system).
In a preferred but non-limiting embodiment, a genetic construct of the invention comprises a) at least one nucleic acid of the invention; operably connected to b) one or more regulatory elements, such as a promoter and optionally a suitable terminator; and optionally also
c) one or more further elements of genetic constructs known per se; in which the terms "regulatory element", "promoter", "terminator" and "operably connected" (as well as all other terms mentioned in the present specification, unless explicitly indicated otherwise) have their usual meaning in the art (for which reference is made to the standard handbooks, such as Sambrook et al, "Molecular Cloning: A Laboratory Manual" ( 2nd.Ed.), VoIs. 1-3, Cold Spring Harbor Laboratory Press (1989); F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987); Lewin, "Genes IT, John Wiley & Sons, New York, N.Y., (1985); Old et al., "Principles of Gene Manipulation: An Introduction to Genetic Engineering", 2nd edition, University of California Press, Berkeley, CA (1981); Roitt et al., "Immunology" (6th. Ed.),
Mosby/Elsevier, Edinburgh (2001); Roitt et al., Roitt' s Essential Immunology, 10 th Ed. Blackwell Publishing, UK (2001); and Janeway et al., "Immunobiology" (6th Ed.), Garland Science Publishing/Churchill Livingstone, New York (2005), as well as to the general background art cited herein); and in which such "further elements" present in the genetic constructs may for example be 3'- or 5'-UTR sequences, leader sequences, selection markers, expression markers/reporter genes, and/or elements that may facilitate or increase (the efficiency of) transformation or integration. These and other suitable elements for such genetic constructs will be clear to the skilled person, and may for instance depend upon the type of construct used, the intended host cell or host organism; the manner in which the nucleotide sequences of the invention of interest are to be expressed (e.g. via constitutive, transient or inducible expression); and/or the transformation technique to be used. For example, regulatory requences, promoters and terminators known per se for the expression and production of antibodies and antibody fragments (including but not limited to (single) domain antibodies and ScFv fragments) may be used in an essentially analogous manner.
Preferably, in the genetic constructs of the invention, said at least one nucleic acid of the invention and said regulatory elements, and optionally said one or more further elements, are "operably linked" to each other, by which is generally meant that they are in a functional relationship with each other. For instance, a promoter is considered "operably linked" to a coding sequence if said promoter is able to initiate or otherwise control/regulate the transcription and/or the expression of a coding sequence (in which said coding sequence should be understood as being "under the control of said promotor). Generally, when two nucleotide sequences are operably linked, they will be in the same orientation and usually also
in the same reading frame. They will usually also be essentially contiguous, although this may also not be required.
Preferably, the regulatory and further elements of the genetic constructs of the invention are such that they are capable of providing their intended biological function in the intended host cell or host organism.
For instance, a promoter, enhancer or terminator should be "operable" in the intended host cell or host organism, by which is meant that (for example) said promoter should be capable of initiating or otherwise controlling/regulating the transcription and/or the expression of a nucleotide sequence - e.g. a coding sequence - to which it is operably linked (as defined herein).
Some particularly preferred promoters include, but are not limited to, promoters known per se for the expression in the host cells mentioned herein; and in particular promoters for the expression in the bacterial cells, such as those mentioned herein and/or those used in the Examples.
A selection marker should be such that it allows - i.e. under appropriate selection conditions - host cells and/or host organisms that have been (successfully) transformed with the nucleotide sequence of the invention to be distinguished from host cells/organisms that have not been (successfully) transformed. Some preferred, but non-limiting examples of such markers are genes that provide resistance against antibiotics (such as kanamycin or ampicillin), genes that provide for temperature resistance, or genes that allow the host cell or host organism to be maintained in the absence of certain factors, compounds and/or (food) components in the medium that are essential for survival of the non-transformed cells or organisms.
A leader sequence should be such that - in the intended host cell or host organism - it allows for the desired post-translational modifications and/or such that it directs the transcribed mRNA to a desired part or organelle of a cell. A leader sequence may also allow for secretion of the expression product from said cell. As such, the leader sequence may be any pro-, pre-, or prepro-sequence operable in the host cell or host organism. Leader sequences may not be required for expression in a bacterial cell. For example, leader sequences known per se for the expression and production of antibodies and antibody fragments (including but not limited to single domain antibodies and ScFv fragments) may be used in an essentially analogous manner.
An expression marker or reporter gene should be such that - in the host cell or host organism - it allows for detection of the expression of (a gene or nucleotide sequence present on) the genetic construct. An expression marker may optionally also allow for the localisation of the expressed product, e.g. in a specific part or organelle of a cell and/or in (a) specific cell(s), tissue(s), organ(s) or part(s) of a multicellular organism. Such reporter genes may also be expressed as a protein fusion with the amino acid sequence of the invention. Some preferred, but non-limiting examples include fluorescent proteins such as GFP.
Some preferred, but non-limiting examples of suitable promoters, terminator and further elements include those that can be used for the expression in the host cells mentioned herein; and in particular those that are suitable for expression bacterial cells, such as those mentioned herein and/or those used in the Examples below. For some (further) non-limiting examples of the promoters, selection markers, leader sequences, expression markers and further elements that may be present/used in the genetic constructs of the invention - such as terminators, transcriptional and/or translational enhancers and/or integration factors - reference is made to the general handbooks such as Sambrook et al. and Ausubel et al. mentioned above, as well as to the examples that are given in WO 95/07463, WO 96/23810, WO 95/07463, WO 95/21191, WO 97/11094, WO 97/42320, WO 98/06737, WO 98/21355, US-A-6,207,410, US-A- 5,693,492 and EP 1 085 089. Other examples will be clear to the skilled person. Reference is also made to the general background art cited above and the further references cited herein.
The genetic constructs of the invention may generally be provided by suitably linking the nucleotide sequence(s) of the invention to the one or more further elements described above, for example using the techniques described in the general handbooks such as Sambrook et al. and Ausubel et al., mentioned above.
Often, the genetic constructs of the invention will be obtained by inserting a nucleotide sequence of the invention in a suitable (expression) vector known per se. Some preferred, but non-limiting examples of suitable expression vectors are those used in the Examples below, as well as those mentioned herein.
The nucleic acids of the invention and/or the genetic constructs of the invention may be used to transform a host cell or host organism, i.e. for expression and/or production of the construct of the invention. Suitable hosts or host cells will be clear to the skilled person, and may for example be any suitable fungal, prokaryotic or eukaryotic cell or cell line or any suitable fungal, prokaryotic or eukaryotic organism, for example:
a bacterial strain, including but not limited to gram-negative strains such as strains of Escherichia coli; of Proteus, for example of Proteus mirabilis; of Pseudomonas, for example of Pseudomonas fluorescens; and gram-positive strains such as strains of Bacillus, for example of Bacillus subtilis or of Bacillus brevis; of Streptomyces, for example of Streptomyces lividans; of Staphylococcus, for example of Staphylococcus carnosus; and of Lactococcus, for example of Lactococcus lactis; a fungal cell, including but not limited to cells from species of Trichoderma, for example from Trichoderma reesei; of Neurospora, for example from Neurospora crassa; of Sordaria, for example from Sordaria macrospora; of Aspergillus, for example from Aspergillus niger or from Aspergillus sojae; or from other filamentous fungi; a yeast cell, including but not limited to cells from species of Saccharomyces, for example of Saccharomyces cerevisiae; of Schizosaccharomyces, for example of Schizosaccharomyces pombe; of Pichia, for example of Pichia pastoris or of Pichia methanolica; of Hansenula, for example of Hansenula polymorpha; of Kluyveromyces, for example of Kluyveromyces lactis; of Arxula, for example oiArxula adeninivorans; of Yarrowia, for example of Yarrowia lipolytica; an amphibian cell or cell line, such as Xenopus oocytes; an insect-derived cell or cell line, such as cells/cell lines derived from lepidoptera, including but not limited to Spodoptera SF9 and Sf21 cells or cells/cell lines derived from Drosophila, such as Schneider and Kc cells; a plant or plant cell, for example in tobacco plants; and/or a mammalian cell or cell line, for example derived a cell or cell line derived from a human, from the mammals including but not limited to CHO-cells, BHK-cells (for example BHK-21 cells) and human cells or cell lines such as HeLa, COS (for example COS-7) and PER.C6 cells; as well as all other hosts or host cells known per se for the expression and production of antibodies and antibody fragments (including but not limited to (single) domain antibodies and ScFv fragments), which will be clear to the skilled person. Reference is also made to the general background art cited hereinabove, as well as to for example WO 94/29457; WO 96/34103; WO 99/42077; Frenken et al., (1998), supra; Riechmann and Muyldermans, (1999), supra; van der Linden, (2000), supra; Thomassen et al., (2002), supra; Joosten et al., (2003), supra; Joosten et al., (2005), supra; and the further references cited herein.
For production on industrial scale, preferred heterologous hosts for the (industrial) production of constructs of the invention include strains of E. coli, Pichia pastoris, S. cerevisiae that are suitable for large scale expression/production/fermentation, and in particular for large scale pharmaceutical expression/production/fermentation. Suitable examples of such strains will be clear to the skilled person. Such strains and production/expression systems are also made available by companies such as Biovitrum (Uppsala, Sweden).
Alternatively, mammalian cell lines, in particular Chinese hamster ovary (CHO) cells, can be used for large scale expression/production/fermentation, and in particular for large scale pharmaceutical expression/production/fermentation. Again, such expression/production systems are also made available by some of the companies mentioned above.
The choice of the specific expression system would depend in part on the requirement for certain post-translational modifications, more specifically glycosylation. The production of a construct for which glycosylation is desired or required would necessitate the use of mammalian expression hosts that have the ability to glycosylate the expressed protein. In this respect, it will be clear to the skilled person that the glycosylation pattern obtained (i.e. the kind, number and position of residues attached) will depend on the cell or cell line that is used for the expression. Preferably, either a human cell or cell line is used (i.e. leading to a protein that essentially has a human glycosylation pattern) or another mammalian cell line is used that can provide a glycosylation pattern that is essentially and/or functionally the same as human glycosylation or at least mimics human glycosylation. Generally, prokaryotic hosts such as E. coli do not have the ability to glycosylate proteins, and the use of lower eukaryotes such as yeast are usually leads to a glycosylation pattern that differs from human glycosylation. Nevertheless, it should be understood that all the foregoing host cells and expression systems can be used in the invention, depending on the desired construct to be obtained.
Thus, according to one non-limiting embodiment of the invention, the construct is glycosylated. According to another non-limiting embodiment of the invention, the construct is non-glycosylated.
According to one preferred, but non-limiting embodiment of the invention, the construct of the invention is produced in a bacterial cell, in particular a bacterial cell suitable for large scale pharmaceutical production, such as cells of the strains mentioned above.
According to another preferred, but non-limiting embodiment of the invention, the construct is produced in a yeast cell, in particular a yeast cell suitable for large scale pharmaceutical production, such as cells of the species mentioned above.
According to yet another preferred, but non-limiting embodiment of the invention, the construct of the invention is produced in a mammalian cell, in particular in a human cell or in a cell of a human cell line, and more in particular in a human cell or in a cell of a human cell line that is suitable for large scale pharmaceutical production, such as the cell lines mentioned hereinabove.
When expression in a host cell is used to produce the constructs of the invention, the constructs can be produced either intracellullarly (e.g. in the cytosol, in the periplasma or in inclusion bodies) and then isolated from the host cells and optionally further purified; or can be produced extracellularly (e.g. in the medium in which the host cells are cultured) and then isolated from the culture medium and optionally further purified. When eukaryotic hosts cells are used, extracellular production is usually preferred since this considerably facilitates the further isolation and downstream processing of the constructs obtained. Bacterial cells such as the strains of E. coli mentioned above normally do not secrete proteins extracellularly, except for a few classes of proteins such as toxins and hemolysin, and secretory production in E. coli refers to the translocation of proteins across the inner membrane to the periplasmic space. Periplasmic production provides several advantages over cytosolic production. For example, the N-terminal amino acid sequence of the secreted product can be identical to the natural gene product after cleavage of the secretion signal sequence by a specific signal peptidase. Also, there appears to be much less protease activity in the periplasm than in the cytoplasm. In addition, protein purification is simpler due to fewer contaminating proteins in the periplasm. Another advantage is that correct disulfide bonds may form because the periplasm provides a more oxidative environment than the cytoplasm. Proteins overexpressed in E. coli are often found in insoluble aggregates, so-called inclusion bodies. These inclusion bodies may be located in the cytosol or in the periplasm; the recovery of biologically active proteins from these inclusion bodies requires a denaturation/refolding process. Many recombinant proteins, including therapeutic proteins, are recovered from inclusion bodies. Alternatively, as will be clear to the skilled person, recombinant strains of bacteria that have been genetically modified so as to secrete a desired protein, and in particular a construct of the invention, can be used.
Thus, according to one non-limiting embodiment of the invention, the construct of the invention is a polypeptide that has been produced intracellularly and that has been isolated from the host cell, and in particular from a bacterial cell or from an inclusion body in a bacterial cell. According to another non-limiting embodiment of the invention, the construct of the invention is a polypeptide that has been produced extracellularly, and that has been isolated from the medium in which the host cell is cultivated.
Some preferred, but non-limiting promoters for use with these host cells include, for expression in E. colϊ. lac promoter (and derivatives thereof such as the lacUV5 promoter); arabinose promoter; left- (PL) and rightward (PR) promoter of phage lambda; promoter of the trp operon; hybrid lac/trp promoters (tac and trc); T7-promoter
(more specifically that of T7-phage gene 10) and other T-phage promoters; promoter of the TnIO tetracycline resistance gene; engineered variants of the above promoters that include one or more copies of an extraneous regulatory operator sequence; for expression in S. cerevisiae: constitutive: ADHl (alcohol dehydrogenase 1), ENO (enolase), CYCl (cytochrome c iso-1), GAPDH (glyceraldehydes-3-phosphate dehydrogenase); PGKl (phosphoglycerate kinase), PYKl (pyruvate kinase); regulated: GALl, 10,7 (galactose metabolic enzymes), ADH2 (alcohol dehydrogenase 2), PHO5 (acid phosphatase), CUPl (copper metallothionein); heterologous: CaMV (cauliflower mosaic virus 35S promoter); - for expression in Pichia pastoris: the AOXl promoter (alcohol oxidase I) for expression in mammalian cells: human cytomegalovirus (hCMV) immediate early enhancer/promoter; human cytomegalovirus (hCMV) immediate early promoter variant that contains two tetracycline operator sequences such that the promoter can be regulated by the Tet repressor; Herpes Simplex Virus thymidine kinase (TK) promoter; Rous Sarcoma Virus long terminal repeat (RSV LTR) enhancer/promoter; elongation factor lα (hEF-lα) promoter from human, chimpanzee, mouse or rat; the SV40 early promoter; HIV-I long terminal repeat promoter; β-actin promoter; Some preferred, but non-limiting vectors for use with these host cells include: vectors for expression in mammalian cells: pMAMneo (Clontech), pcDNA3 (Invitrogen), pMClneo (Stratagene), ρSG5 (Stratagene), EBO-pSV2-neo (ATCC
37593), pBPV-1 (8-2) (ATCC 37110), pdBPV-MMTneo (342-12) (ATCC 37224), pRSVgpt (ATCC37199), pRSVneo (ATCC37198), pSV2-dhfr (ATCC 37146), pUCTag
(ATCC 37460) and 1ZD35 (ATCC 37565), as well as viral-based expression systems, such as those based on adenovirus; vectors for expression in bacterials cells: pET vectors (Novagen) and pQE vectors
(Qiagen); vectors for expression in yeast or other fungal cells: pYES2 (Invitrogen) and Pichia expression vectors (Invitrogen); vectors for expression in insect cells: pBlueBacH (Invitrogen) and other baculovirus vectors
- ■ vectors for expression in plants or plant cells: for example vectors based on cauliflower mosaic virus or tobacco mosaic virus, suitable strains of Agrobacterium, or Ti-plasmid based vectors. Some preferred, but non-limiting secretory sequences for use with these host cells include: for use in bacterial cells such as E. coli: PeIB, BIa, OmpA, OmpC, OmpF, OmpT, StII,
PhoA, PhoE, MaIE, Lpp, LamB, and the like; TAT signal peptide, hemolysin C- terminal secretion signal for use in yeast: α-mating factor prepro-sequence, phosphatase (phol), invertase (Sue), etc.; for use in mammalian cells: indigenous signal in case the target protein is of eukaryotic origin; murine Ig κ-chain V-J2-C signal peptide; etc. Suitable techniques for transforming a host or host cell of the invention will be clear to the skilled person and may depend on the intended host cell/host organism and the genetic construct to be used. Reference is again made to the handbooks and patent applications mentioned above.
After transformation, a step for detecting and selecting those host cells or host organisms that have been succesfully transformed with the nucleotide sequence/genetic construct of the invention may be performed. This may for instance be a selection step based on a selectable marker present in the genetic construct of the invention or a step involving the detection of the amino acid sequence of the invention, e.g. using specific antibodies.
The transformed host cell (which may be in the form or a stable cell line) or host organisms (which may be in the form of a stable mutant line or strain) form further aspects of the present invention.
Preferably, these host cells or host organisms are such that they express, or are (at least) capable of expressing (e.g. under suitable conditions), an amino acid sequence of the
invention (and in case of a host organism: in at least one cell, part, tissue or organ thereof). The invention also includes further generations, progeny and/or offspring of the host cell or host organism of the invention, that may for instance be obtained by cell division or by sexual or asexual reproduction.
To produce/obtain expression of the amino acid sequences of the invention, the transformed host cell or transformed host organism may generally be kept, maintained and/or cultured under conditions such that the (desired) construct of the invention is expressed/produced. Suitable conditions will be clear to the skilled person and will usually depend upon the host cell/host organism used, as well as on the regulatory elements that control the expression of the (relevant) nucleotide sequence of the invention. Again, reference is made to the handbooks and patent applications mentioned above in the paragraphs on the genetic constructs of the invention.
Generally, suitable conditions may include the use of a suitable medium, the presence of a suitable source of food and/or suitable nutrients, the use of a suitable temperature, and optionally the presence of a suitable inducing factor or compound (e.g. when the nucleotide sequences of the invention are under the control of an inducible promoter); all of which may be selected by the skilled person. Again, under such conditions, the constructs of the invention may be expressed in a constitutive manner, in a transient manner, or only when suitably induced. It will also be clear to the skilled person that the construct of the invention may (first) be generated in an immature form (as mentioned above), which may then be subjected to post-translational modification, depending on the host cell/host organism used. Also, the construct of the invention may be glycosylated, again depending on the host cell/host organism used.
The construct of the invention may then be isolated from the host cell/host organism and/or from the medium in which said host cell or host organism was cultivated, using protein isolation and/or purification techniques known per se, such as (preparative) chromatography and/or electrophoresis techniques, differential precipitation techniques, affinity techniques (e.g. using a specific, cleavable amino acid sequence fused with the amino acid sequence of the invention) and/or preparative immunological techniques (i.e. using antibodies against the amino acid sequence to be isolated).
Generally, for pharmaceutical use, the polypeptides of the invention may be formulated as a pharmaceutical preparation comprising at least one polypeptide of the
invention and at least one pharmaceutically acceptable carrier, diluent or excipient and/or adjuvant, and optionally one or more further pharmaceutically active polypeptides and/or compounds. By means of non-limiting examples, such a formulation may be in a form suitable for oral administration, for parenteral administration (such as by intravenous, intramuscular or subcutaneous injection or intravenous infusion), for topical administration, for administration by inhalation, by a skin patch, by an implant, by a suppository, etc.. Such suitable administration forms - which may be solid, semi-solid or liquid, depending on the manner of administration - as well as methods and carriers for use in the preparation thereof, will be clear to the skilled person, and are further described herein. Thus, in a further aspect, the invention relates to a pharmaceutical preparation or composition that contains at least one construct of the invention or at least one polypeptide of the invention and at least one suitable carrier, diluent or excipient (i.e. suitable for pharmaceutical use), and optionally one or more further active substances.
Generally, the pharmaceutical preparation or composition may be any suitable preparation composition for delivering the construct of the invention to the circulation of the subject to be treated via any suitable route, such as for example intravenous or intramuscular administration (i.e. by infusion or injection), parenteral administration, intranasal administration, administration via the lungs or administration through the skin, or via any other suitable route. Also, for the purposes of such administration, and in addition to the effect on increasing half-life as described herein, it is envisaged that the serum albumin domain IH sequences (as described herein) will allow the constructs comprising the same (also as described herein) to be transported across biological membranes (i.e. such as cell layers, for example layers of epithelial cells such as the wall of the gastrointestinal tract) and/or will provide for increased transport across biological membranes (i.e. faster transport and/or an increased amount transported). In particular, and although the invention is not limited to any particular mechanism, explanation or hypothesis, it is assumed that the presence of the serum albumin domain HI sequences in the constructs of the invention will allow the constructs to bind to FcRn and thus to be transported (e.g. leading to increased transport compared to the therapeutic moiety per se) through a biological membrane (i.e. that contains or has FcRn on its surface), i.e. by transcytosis.
Thus, without being limited thereto, it is envisaged that the constructs of the invention will, upon suitable administration into the gastrointestinal tract, provide for increased
transport (i.e. compared to the therapeutic moiety per se) through the wall of the gastrointestinal tract (or through the wall of any part(s) of the gastrointestinal tract where FcRn is present and/or is involved in transport, such as the intestines), leading to increased concentrations of the construct in the circulation (whereupon the use of the constructs of the invention may then also provide for an increased half-life, as described herein). This makes the constructs of the invention particularly useful for administration into the gastrointestinal tract, for example by means of oral administration or using an enema or suppository.
Thus, another aspect of the invention relates to a pharmaceutical formulation that is suitable for administration into the gastrointestinal tract (or to at least one part thereof) and which comprises at least one construct of the invention and optionally one or more excipients, carriers, diluents and other components of such formulations known per se (and optionally one or more further pharmaceutically active substances. Such a formulation may for example be such that it delivers the construct of the invention to the gastrointestinal tract (or to at least one intended to desired part thereof) and/or releases the construct of the invention in the gastrointestinal tract (or in at least one intended or desired part thereof). Thus, for example, the composition or preparation may be a composition or preparation that is suitable for oral administration or for administration as a suppository or an enema.
Generally, for the purposes of administration as described above, the constructs of the invention can be formulated and administered in any suitable manner known per se, for which reference is for example made to the general background art cited above (and in particular to WO 04/041862, WO 04/041863, WO 04/041865 and WO 04/041867) as well as to the standard handbooks, such as Remington's Pharmaceutical Sciences, 18 th Ed., Mack Publishing Company, USA (1990) or Remington, the Science and Practice of Pharmacy, 21th Edition, Lippincott Williams and Wilkins (2005).
For example, the constructs of the invention may be formulated and administered in any manner known per se for conventional antibodies and antibody fragments (including ScFv' s and diabodies) and other pharmaceutically active proteins. Such formulations and methods for preparing the same will be clear to the skilled person, and for example include preparations suitable for parenteral administration (for example intravenous, intraperitoneal, subcutaneous, intramuscular, intraluminal, intra-arterial or intrathecal administration) or for topical (i.e. transdermal or intradermal) administration. Reference is also made to the prior art mentioned herein.
Preparations for parenteral administration may for example be sterile solutions, suspensions, dispersions or emulsions that are suitable for infusion or injection. Suitable carriers or diluents for such preparations for example include, without limitation, sterile water and aqueous buffers and solutions such as physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hank's solution; water oils; glycerol; ethanol; glycols such as propylene glycol or as well as mineral oils, animal oils and vegetable oils, for example peanut oil, soybean oil, as well as suitable mixtures thereof. Usually, aqueous solutions or suspensions will be preferred.
Thus, the constructs of the invention may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the constructs of the invention may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of the construct of the invention. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of the construct of the invention in such therapeutically useful compositions is such that an effective dosage level will be obtained.
The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the construct of the invention, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material
used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
Preparations and formulations for oral administration may also be provided with an enteric coating that will allow the constructs of the invention to resist the gastric environment and pass into the intestines, where the construct of the invention may then be released. More generally, preparations and formulations for oral administration may be suitably formulated for delivery into any desired part of the gastrointestinal tract. In addition, suitable suppositories may be used for delivery into the gastrointestinal tract.
The constructs of the invention may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the constructs of the invention or their salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form must be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the constructs of the invention in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of
sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile- filtered solutions.
The constructs of the invention can generally be used in the prevention and treatment of any disease or disorder for which the therapeutic moiety is used or can be used, as will be clear to the skilled person. In such applications, the constructs of the invention will generally provide an increased half-life, and therefore a prolonged therapeutic effect, compared to the therapeutic moiety per se. Also, when the therapeutic moiety is (potentially) immunogenic, the presence of the domain LII sequence may reduce the immunogenicity of the therapeutic moiety.
The amount of the constructs of the invention to be administered, as well as the route of administration and the administration regimen, for prophylaxis or treatment will vary with the disease or disorder to be prevented or treated, the therapeutic moiety used, the half-life of the construct. The amount of the constructs to be administered and the administration regimen may also vary with the route of administration, the nature of the condition being treated and the age and condition of the patient, and can be suitably determined by the attendant physician or clinician, optionally using only routine experimentation given the teachings herein. See Remington's Pharmaceutical Sciences (Martin, E.W., ed. 4), Mack Publishing Co., Easton, PA.
The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. Generally, because the constructs of the inventions have an increased half-life they will usually be administered less frequently and/or at lower doses than the therapeutic moiety per se.
In another aspect, the invention relates to a protein or polypeptide that comprises or essentially consists of at least one serum albumin domain IQ sequence, which protein or polypeptide is preferably in essentially isolated form. Such a protein or polypeptide can be used to increase the half-life of a therapeutic moiety, i.e. by linking (e.g. covalently or non- covalently) the protein or polypeptide to said therapeutic moiety in order to provide a construct of the invention.
Such a domain IQ sequence may essentially be as described herein for the domain III sequences that are included in the constructs of the invention, and may for example be a
derived from a naturally occurring serum albumin or may be of recombinant, synthetic or semi-synthetic origin (including but not limited to analogs, mutants, variants, parts or fragments of a naturally occurring domain III sequence).
Said protein or polypeptide is preferably derived from a mammal, more preferably from human serum albumin.
Preferably, said protein or polypeptide comprises less than 250 amino acid residues, preferably less than 200 amino acid residues, more preferably less than 150 amino acid residues.
More preferably, said protein or polypeptide comprises or essentially consist of the amino acid sequence of SEQ ED NO: 1, and in particular an analog, mutant, variant, part or fragment of the amino acid sequence of SEQ ID NO: 1, in which such an analog, mutant, variant, part or fragment may essentially be as defined herein for the domain IH sequences that are included in the constructs of the invention.
The invention also relates to a nucleotide sequence or nucleic acid that encodes at least one such protein or polypeptide, which is preferably as described above and which is more preferably in the form of a genetic construct, also as described above.
The invention also relates to a host cell that comprises at least one such nucleotide sequence, nucleic acid or genetic construct and/or that expresses or is capable of expressing at least one such protein or polypeptide. The protein or polypeptide can be used as a moiety that can be linked to a therapeutic moiety (as described above) in order to increase the half-life thereof. Such therapeutic moieties will be clear to the skilled person and may for example comprise or essentially consist of a therapeutic protein, polypeptide, compound, factor or other entity.
Methods for linking the protein or polypeptide to such a therapeutic moiety will be clear to the skilled person, and may for example include the methods described in the prior art cited above for linking albumin or fragments thereof to therapeutic moieties. For this purpose, the protein or polypeptide may also be chemically activated in a manner known per se, as will be clear to the skilled person, and such chemically activated proteins or polypeptides form a further aspect of the invention. In another aspect, the invention relates to a method for preparing a therapeutic molecule, conjugate, complex or entity, which method comprises linking (i.e. covalently or non-covalently, for example by chemical reaction) at least one protein or polypeptide as described herein to at least one therapeutic moiety. The invention also relates to the
therapeutic molecule, conjugate, complex or entity thus obtained; to pharmaceutical compositions that contain or comprise such therapeutic molecule, conjugate, complex or entity; and to therapeutic uses thereof (all essentially as described herein for the compositions and uses of the constructs of the invention).
Experimental part: Fusion of Nanobody to domain III of human serum albumin
Example 1: Construction of DomDI and Nanobodv-HSA Pom Hl fusion proteins.
The amino acid sequence of SEQ ID NO: 3 (Dili of human serum albumin) was constructed by gene assembly and cloned into pPICZaA as Xhol/Notl fragment. For the generation of a Nanobody-DIH fusion protein, the Nanobody of SEQ ID NO:4 was amplified by PCR using primer pair:
5 ' -GGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTGAGGTGCAGCTGGTGGA
GTCTGGG-3' [SEQ ID NO:5] and 5 ' -ACAGTTCTGCTTAATTAAGTTTTGAGGCTCTTC AACTGA
GGAGACGGTGACCTG-3' [SEQ ID NO:6]
The resulting PCR product was cloned into PCR4TOPO and used to clone the
Nanobody N-terminally of D-IH Hereto, pPICZaA D-III and TOPO Nanobody-N were digested with Xhol and Pad and ligated to each other. To connect Nanobody to the C-terminus of D-III interspaced with a linker, the following nested-PCR was performed: Nanobody was first amplified by PCR using primer pair:
5 ' -GTGGATCCGGAGGCAGTGGAGGTTCTGGTGGGTCAGGAGGTGAGGTGCA
GCTGGTGGAGTCTGGG-3' [SEQ ID NO:7] and 5'-TAGAAAGCTGGCGGCCGCTTATTATGAGGAGACGGTGACCTG-S' [SEQ ID
NO:8]
A second PCR was performed on the obtained product to insert a GlySer linker [
GGSGGSGGSGGSGG, SEQ ID NO:9] by use of primer pair
5 ' -TTGGTTGCGGCCAGTCAGGCCGCACTTGGTTTGGGTGGATCCGGAGGCAG TG-3' [SEQ ID NO: 10] and 5'-TAGAAAGCTGGCGGCCGCTTATTATGAGGAGACGGTGACCTG-S' [SEQ ID
NO: H].
The resulting PCR product was cloned into PCR4TOPO and used to clone Nanobody at the C-terminus of D-III. Hereto, pPICZaA D-III and TOPO Nanobody-C were digested with Notl and Sfil and ligated to each other.
For the final construction, these plasmids were digested with Sfil/Notl generating an opened pPICZaA Nanobody-Diπ and Nanobody fragment. By ligation of these fragments, a Nanobody-Dm-(GGS) 4 GG-Nanobody fusion construct [Figure 2, SEQ ID NO: 12 (nucleotide sequence) and SEQ ID NO: 13 (amino acid sequence)] was generated in pPICZaA.
Example 2: Expression of the fusion protein and D-III in Pichia pastoris. Expression of the D-III domain and Nanobody-DIϋ-(GGS) 4 GG-Nanobody fusion protein was performed in Pichia pastoris in shake flasks or in a fermentor, using standard expression techniques and regulatory elements known per se. Production levels of >50 mg/1 were obtained.
Example 3: Surface plasmon resonance.
Surface plasmon resonance measurements were performed using a Biacore 3000 instrument at 25°C. 700RU recombinant hFcRn-B2M-GST was immobilized onto a CM5 sensorchip (Biacore AB) using standard primary amine coupling chemistry essentially as described in the manufacturer's protocol. 2 μM of each sample were injected over immobilized hFcRn-GST during 5 minutes in running buffer (5OmM Na2HPO4, 15OmM NaCl) at pH5.
Binding of D-HI to hFcRn was not affected upon fusion with the Nanobody; see Figure 3.
